2017-02-08 REL 2016-02-01 PDBe PDBe 2016-02-10 2016-02-24 CryoEM structure of the CMG replicative helicase bound to a DNA fork (relaxed state) Abid Ali F, Renault L, Costa A Cdc45, GINS, MCM, CMG, helicase, DNA replication Abid Ali F, Renault L, Gannon J, Gahlon H L, Kotecha A, Chuan Zhou J, Rueda D, Costa A Cryo-EM structures of the eukaryotic replicative helicase bound to a translocation substrate NAT.COMMUN. 7 n/a n/a 2016 26888060 doi:10.1038/ncomms10708 emd_3319.map.gz Image stored as Reals 112 112 112 0 0 0 111 111 111 112 112 112 302.4 302.4 302.4 90.0 90.0 90.0 X Y Z -0.05939161 0.22069867 0.00363789 0.01793187 1
::::EMDATABANK.org::::EMD-3319::::
2.7 2.7 2.7 0.0895 CMG treated with forked DNA substrate in the presence of ATPgS in a relaxed Mcm5-2 AAA+ configuration
emd_3319.tif
emd_3319_fsc.xml 13 CMG treated with forked DNA substrate and ATPgS 0.7 0.7 protein Mcm2 0.1 0.1 Monomer Fruit fly true Drosophila melanogaster 1 P49735 IPR008045 Trichoplusia ni pFastBac-Mcm2 High Five nucleic-acid Model replication DNA fork leading strand template synthetic construct true OTHER CACTCGGGCTCGTTTTACAACGTCGTGACTGGGCACTTGATCGGCCAACCTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT DNA nucleic-acid Model replication DNA fork lagging strand template true OTHER DNA CTGGCGTCGGGTCGGCGGTTGGCCGATCAAGTGCCCAGTCACGACGTTGTAAAACGAGCCCGAGTG synthetic construct protein Mcm3 0.09 0.09 Drosophila melanogaster Monomer Fruit fly true 1 IPR008046 Q9XYU1 pFastBac-Mcm3 unidentified baculovirus protein Mcm4 0.097 0.097 true Drosophila melanogaster 1 Fruit fly Monomer IPR008047 Q26454 unidentified baculovirus pFastBac-Mcm4 protein Mcm5 0.082 0.082 Fruit fly true 1 Drosophila melanogaster Monomer IPR008048 Q9VGW6 pFastBac-Mcm5 unidentified baculovirus protein Mcm6 0.092 0.092 1 true Monomer Fruit fly Drosophila melanogaster Q9V461 IPR008049 pFastBac-Mcm6 unidentified baculovirus protein Mcm7 0.081 0.081 Drosophila melanogaster Monomer true 1 Fruit fly Q9XYU0 IPR008050 unidentified baculovirus pFastBac-Mcm7 protein Cdc45 0.066 0.066 1 Drosophila melanogaster true Monomer Fruit fly IPR003874 O96989 pFastBac-Cdc45 unidentified baculovirus protein Psf1 0.023 0.023 1 Fruit fly true Drosophila melanogaster Monomer Q9W0I7 IPR021151 unidentified baculovirus pFastBac-Psf1 protein Psf2 0.023 0.023 Fruit fly 1 Drosophila melanogaster true Monomer Q9VQY9 IPR007257 unidentified baculovirus pFastBac-Psf2 protein Psf3 0.025 0.025 Monomer true Fruit fly Drosophila melanogaster 1 Q9W2V7 IPR010492 pFastBac-Psf3 unidentified baculovirus protein Sld5 0.026 0.026 1 Monomer Fruit fly Drosophila melanogaster true IPR008591 Q9VBI1 unidentified baculovirus pFastBac-Sld5 Blot for 4 seconds before plunging ETHANE 100 FEI VITROBOT MARK IV Multi cartridge holder FEI POLARA 300 FLOOD BEAM 1700 GIF GATAN K2 SUMMIT (4k x 4k) OTHER 07-AUG-2015 0-20 300 BRIGHT FIELD 48 37037 3500 2.0 FIELD EMISSION GUN FLOOD BEAM BRIGHT FIELD GATAN K2 SUMMIT (4k x 4k) FIELD EMISSION GUN 3500 GIF FEI POLARA 300 0-20 Multi cartridge holder 48 OTHER 37037 07-AUG-2015 2.0 1700 300 2098 5 32
data was recorded as movies of 25 frames
 particle Quantifoil 1.2/1.3 or C-flat 1/1
25 mM Hepes, 50 mM sodium acetate, 10 mM magnesium acetate, 1 mM DTT, 0.1mM ATPgammaS
7.6 singleParticle RELION1.4 Each particle 9.8 FSC 0.143, gold-standard C1 13692
Particles were picked in EMAN2; Contrast Transfer Function was estimated using CTFFIND4. All further processing was performed within the RELION 1.4 environment.