2016-04-13 REL 2015-08-26 RCSB RCSB 2015-09-23 2016-02-17 Three-dimensional structure of the core MMTV intasome Ballandras-Colas A, Brown M, Cook N, Demeler B, Cherepanov P, Lyumkis D, Engelman AN integration, retrovirus, integrase 3jca Ballandras-Colas A, Brown M, Cook NJ, Dewdney TG, Demeler B, Cherepanov P, Lyumkis D, Engelman AN Cryo-EM reveals a novel octameric integrase structure for betaretroviral intasome function NATURE 530 358 361 2016 26887496 doi:10.1038/nature16955 emd_6441.map.gz Image stored as Reals 256 256 256 0 0 0 255 255 255 256 256 256 335.36 335.36 335.36 90.0 90.0 90.0 X Y Z -0.73394287 1.69667494 0.00224670 0.04419288 1
::::EMDATABANK.org::::EMD-6441::::
1.31 1.31 1.31 0.5 Reconstruction of the core MMTV intasome 2 Mouse Mammary Tumor Virus intasome complex Integrase octamer bound to two vDNA strands 194
IN-NTD and IN-CCD domains of flanking INs 5-8 computationally removed. The oligomeric state of the computationally processed sample is therefore an IN tetramer + IN-CTD tetramer + two vDNAs.
sedimentation velocity centrifugation protein betaretroviral integrase MMTV IN 0.036 8 octamer Mouse mammary tumor virus MMTV true Escherichia coli BL21(DE3) PC2 pET-15b nucleic-acid MMTV U5 DNA end viral DNA 0.013 DNA DOUBLE HELIX Mouse mammary tumor virus true MMTV CAGGTCGGCCGACTGCGGCA 3 uL of sample was applied to the grid, adsorbed for 30 seconds, blotted, and plunge-frozen in liquid ethane. ETHANE 90 HOMEMADE PLUNGER 77 Objective lens astigmatism was corrected using Leginon, and coma-free alignment was established. FIELD EMISSION GUN 40 BRIGHT FIELD 1000 4000 FLOOD BEAM GATAN K2 (4k x 4k) 2.7 38167 FEI TITAN KRIOS 15-APR-2015 FEI TITAN KRIOS AUTOGRID HOLDER 300 22500 2714 particle 400 mesh C-flat, plasma-treated for 6 seconds
25 mM Tris-HCl, 200 mM NaCl, 2 mM DTT, 25 uM ZnCl2, 10 mM CaCl2
7.4 singleParticle projection matching Frealign, phi, theta, psi Frealign each particle
Local FSC values range from 5 to 6 Angstrom.
4.8 FSC 0.143, semi-independent C2 30307
IN-NTD and IN-CCD domains of flanking INs 5-8 were computationally removed using Relion after assigning Euler angles to full octameric particles and masking out the flanking regions.